Basic information from miRBase |
hairpin accession number: MI0005829 |
Located between position 19445185 and 19445275 on chromosome X strand + |
mature miRNAs for MI0005829: |
dme-miR-972-5p (MIMAT0020869): TAAATATTTTTTTTGTATAAA |
dme-miR-972-3p (MIMAT0005488): TGTACAATACGAATATTTAGGC |
References |
[1]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" ![]() |
more data |
Data from CoGemiR |