Basic information from miRBase |
hairpin accession number: MI0008543 |
Located between position 57507346 and 57507431 on chromosome 17 strand - |
mature miRNAs for MI0008543: |
ptr-miR-142 (MIMAT0008037): TGTAGTGTTTCCTACTTTATGGA |
You can find this miRNA in ENTREZGENE: MIR142 (accession: 100316102) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |