| Basic information from miRBase |
| hairpin accession number: MI0015742 |
| Located between position 3199937 and 3200003 on chromosome 9q strand + |
| mature miRNAs for MI0015742: |
| cin-miR-4185-5p (MIMAT0016802): CAGCGGTGATGATAATAC |
| cin-miR-4185-3p (MIMAT0016803): TGTATTCATACTGTCTGAGCTG |
| You can find this miRNA in ENTREZGENE: mir4185 (accession: 100498997) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |