Basic information from miRBase |
hairpin accession number: MI0015742 |
Located between position 3199937 and 3200003 on chromosome 9q strand + |
mature miRNAs for MI0015742: |
cin-miR-4185-5p (MIMAT0016802): CAGCGGTGATGATAATAC |
cin-miR-4185-3p (MIMAT0016803): TGTATTCATACTGTCTGAGCTG |
You can find this miRNA in ENTREZGENE: mir4185 (accession: 100498997) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" ![]() |