| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0005835 |
| Located between position 19455269 and 19455360 on chromosome X strand + |
| mature miRNAs for MI0005835: |
| dme-miR-978-5p (MIMAT0020875): TGCAATCTACGCCACTGGCTTACG |
| dme-miR-978-3p (MIMAT0005494): TGTCCAGTGCCGTAAATTGCAG |
| References |
| [1]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" |
| more data |
| Data from CoGemiR |