miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0006230
Located between position 4560 and 4725 on chromosome scaffold_5 strand +
mature miRNAs for MI0006230:
         cre-miR1170.2 (MIMAT0005428): AATCAGCCAAACACGGCAGA
         cre-miR1170.1 (MIMAT0005429): TGTCCATCGCCAAGTTGCCAG

References
[1]Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC, Nature. 447:1126-1129(2007)., "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii"