miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0000634
Located between position 35707795 and 35707892 on chromosome 14 strand +
Overlapping with sense strand of Grid1-001 (intron 2).
(Ensemble: OTTMUST00000083227)
mature miRNAs for MI0000634:
         mmu-miR-346 (MIMAT0000597): TGTCTGCCCGAGTGCCTGCCTCT
         mmu-miR-346* (MIMAT0017039): AGGCAGGGGCTGGGCCTGCAGC
You can find this miRNA in ENTREZGENE: Mirn346 (accession: 723847)

References
[1]Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G, Proc Natl Acad Sci U S A. 101:360-365(2004)., "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
[2]Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A, Mol Hum Reprod. 16:463-471(2010)., "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
[3]Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"


more data
Expression data from PhenomiR