| Basic information from miRBase |
| hairpin accession number: MI0009810 |
| Located between position 40932048 and 40932142 on chromosome 28 strand - |
| mature miRNAs for MI0009810: |
| bta-miR-346 (MIMAT0009297): TGTCTGCCCGCATGCCTGCCTCT |
| You can find this miRNA in ENTREZGENE: MIR346 (accession: 100313261) |
| References |
| [1]Artzi S, Kiezun A, Shomron N, BMC Bioinformatics. 9:39(2008)., "miRNAminer: a tool for homologous microRNA gene search" |
| [2]Strozzi F, Mazza R, Malinverni R, Williams JL, Anim Genet. 40:125(2009)., "Annotation of 390 bovine miRNA genes by sequence similarity with other species" |