| Basic information from miRBase |
| hairpin accession number: MI0012658 |
| Located between position 84117510 and 84117604 on chromosome 1 strand + |
| Overlapping with sense strand of LOC100064635 (intron 1). |
| (Ensemble: ENSECAT00000029043) |
| mature miRNAs for MI0012658: |
| eca-miR-346 (MIMAT0012902): TGTCTGCCCGCATGCCTGCCTCT |
| You can find this miRNA in ENTREZGENE: MIR346 (accession: 100314780) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |