| Basic information from miRBase |
| hairpin accession number: MI0008631 |
| Located between position 86429910 and 86430003 on chromosome 10 strand - |
| Overlapping with sense strand of (intron 2). |
| (Ensemble: ENSPTRT00000005097) |
| mature miRNAs for MI0008631: |
| ptr-miR-346 (MIMAT0008112): TGTCTGCCCGCATGCCTGCCTCT |
| You can find this miRNA in ENTREZGENE: MIR346 (accession: 100316462) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |