| Basic information from miRBase |
| hairpin accession number: MI0012900 |
| Located between position 42745020 and 42745108 on chromosome 24 strand + |
| Overlapping with antisense strand of LOC100056048 (exon 1). |
| (Ensemble: ENSECAT00000005871) |
| mature miRNAs for MI0012900: |
| eca-miR-431 (MIMAT0013156): TGTCTTGCAGGCCGTCATGCAGG |
| You can find this miRNA in ENTREZGENE: MIR431 (accession: 100315081) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |