| Basic information from miRBase |
| hairpin accession number: MI0007623 |
| Located between position 164338614 and 164338686 on chromosome 7 strand + |
| mature miRNAs for MI0007623: |
| mml-miR-134 (MIMAT0006190): TGTGACTGGTTGACCAGAGGGG |
| You can find this miRNA in ENTREZGENE: MIR134 (accession: 100315511) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |