| Basic information from miRBase |
| hairpin accession number: MI0008535 |
| Located between position 101486247 and 101486318 on chromosome 14 strand + |
| mature miRNAs for MI0008535: |
| ptr-miR-134 (MIMAT0008031): TGTGACTGGTTGACCAGAGGGG |
| You can find this miRNA in ENTREZGENE: MIR134 (accession: 100316443) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |