| Basic information from miRBase |
| hairpin accession number: MI0011322 |
| Located between position 696340 and 696414 on chromosome 14 strand + |
| Overlapping with sense strand of LOC786966 (intron 14). |
| (Ensemble: ENSBTAT00000015828) |
| mature miRNAs for MI0011322: |
| bta-miR-2309 (MIMAT0011821): TGTGAGGGTGGTGGACGGCAGGG |
| You can find this miRNA in ENTREZGENE: MIR2309 (accession: 100313130) |
| References |
| [1]Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ, PLoS One. 4:e6349(2009)., "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" |