miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008497
Located between position 156326151 and 156326291 on chromosome 5 strand +
Overlapping with sense strand of (intron 3).
(Ensemble: ENSPTRT00000030838)
mature miRNAs for MI0008497:
         ptr-miR-1294 (MIMAT0008013): TGTGAGGTTGGCATTGTTGTCT
You can find this miRNA in ENTREZGENE: MIR1294 (accession: 100316084)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"