| Basic information from miRBase |
| hairpin accession number: MI0008497 |
| Located between position 156326151 and 156326291 on chromosome 5 strand + |
| Overlapping with sense strand of (intron 3). |
| (Ensemble: ENSPTRT00000030838) |
| mature miRNAs for MI0008497: |
| ptr-miR-1294 (MIMAT0008013): TGTGAGGTTGGCATTGTTGTCT |
| You can find this miRNA in ENTREZGENE: MIR1294 (accession: 100316084) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |