miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0000848
Located between position 139740932 and 139741027 on chromosome X strand -
mature miRNAs for MI0000848:
         rno-miR-19b-2* (MIMAT0017097): AGTTTTGCAGATTTGCAGTTCAG
         rno-miR-19b (MIMAT0000788): TGTGCAAATCCATGCAAAACTGA
You can find this miRNA in ENTREZGENE: Mir19b-2 (accession: 100313999)

References
[1]Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G, Proc Natl Acad Sci U S A. 101:360-365(2004)., "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
[2]Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H, Genes Dev. 20:1732-1743(2006)., "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes"
[3]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[4]Linsen SE, de Wit E, de Bruijn E, Cuppen E, BMC Genomics. 11:249(2010)., "Small RNA expression and strain specificity in the rat"