miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0002997
Located between position 92019060 and 92019141 on chromosome 13 strand +
Overlapping with sense strand of (exon 3).
(Ensemble: ENSPTRT00000054347)
mature miRNAs for MI0002997:
         ptr-miR-19a (MIMAT0002696): TGTGCAAATCTATGCAAAACTGA
You can find this miRNA in EMBL: AY866314 (accession: AY866314)

References
[1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes"