miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013841
Located between position 43202791 and 43202860 on chromosome 1 strand -
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018342)
mature miRNAs for MI0013841:
         tgu-miR-19a (MIMAT0014611): TGTGCAAATCTATGCAAAGC

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"