| Basic information from miRBase |
| hairpin accession number: MI0015565 |
| Located between position 826440 and 826494 on chromosome 1q strand - |
| Overlapping with sense strand of (intron 2). |
| (Ensemble: ENSCINT00000024072) |
| mature miRNAs for MI0015565: |
| cin-miR-4017-5p (MIMAT0016524): TGTGCTGTATATGCACTTCT |
| cin-miR-4017-3p (MIMAT0016525): TAAGTGCATGTATGGTGCTA |
| You can find this miRNA in ENTREZGENE: mir4017-1 (accession: 100499059) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |