| Basic information from miRBase |
| hairpin accession number: MI0008803 |
| Located between position 4946051 and 4946146 on chromosome 8_random strand + |
| Overlapping with sense strand of XM_001137443.1 (intron 17). |
| (Ensemble: ENSPTRT00000037017) |
| mature miRNAs for MI0008803: |
| ptr-miR-597 (MIMAT0008266): TGTGTCACTCGATGACCACTGT |
| You can find this miRNA in ENTREZGENE: MIR597 (accession: 100316396) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |