miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0000381
Located between position 17574610 and 17574702 on chromosome 2L strand +
mature miRNAs for MI0000381:
         dme-miR-287-3p (MIMAT0000360): TGTGTTGAAAATCGTTTGCAC
You can find this miRNA in TARGETS:MIRTE: miR-287 (accession: miR-287)

References
[1]Lai EC, Tomancak P, Williams RW, Rubin GM, Genome Biol. 4:R42(2003)., "Computational identification of Drosophila microRNA genes"


more data
Data from CoGemiR