| Basic information from miRBase |
| hairpin accession number: MI0015866 |
| Located between position 61918160 and 61918218 on chromosome 20 strand + |
| Overlapping with sense strand of ARFGAP1-019 (intron 2). |
| (Ensemble: OTTHUMT00000378039) |
| mature miRNAs for MI0015866: |
| hsa-miR-4326 (MIMAT0016888): TGTTCCTCTGTCTCCCAGAC |
| You can find this miRNA in ENTREZGENE: MIR4326 (accession: 100422945) |
| References |
| [1]Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP, PLoS One. 4:e7192(2009)., "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" |