| Basic information from miRBase |
| hairpin accession number: MI0013508 |
| Located between position 481079 and 481149 on chromosome CH477533.1 strand + |
| mature miRNAs for MI0013508: |
| aae-miR-2943 (MIMAT0014301): TTAAGTAGGCACTTGCAGGCAAA |
| References |
| [1]Li S, Mead EA, Liang S, Tu Z, BMC Genomics. 10:581(2009)., "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" |