| Basic information from miRBase |
| hairpin accession number: MI0015579 |
| Located between position 31120 and 31173 on chromosome scaffold_156 strand - |
| mature miRNAs for MI0015579: |
| cin-miR-4028-3p (MIMAT0016546): TTAATGATGTTGTTGTTGCA |
| You can find this miRNA in ENTREZGENE: mir4028 (accession: 100498911) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |