| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0007198 |
| Located between position 133886 and 134023 on chromosome reftig_1 strand - |
| Overlapping with sense strand of (intron 1). |
| (Ensemble: ENSCSAVT00000002621) |
| mature miRNAs for MI0007198: |
| csa-miR-155 (MIMAT0006131): TTAATGCTAATAAGTGATTTATG |
| References |
| [1]Fu X, Adamski M, Thompson EM, Mol Biol Evol. 25:1067-1080(2008)., "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" |
| more data |
| Data from CoGemiR |