| Basic information from miRBase |
| hairpin accession number: MI0008554 |
| Located between position 25402135 and 25402198 on chromosome 21 strand + |
| mature miRNAs for MI0008554: |
| ptr-miR-155 (MIMAT0008048): TTAATGCTAATCGTGATAGGGGT |
| You can find this miRNA in ENTREZGENE: MIR155 (accession: 100316447) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |