| Basic information from miRBase |
| hairpin accession number: MI0015560 |
| Located between position 1671438 and 1671489 on chromosome 12q strand + |
| Overlapping with antisense strand of (intron 5). |
| (Ensemble: ENSCINT00000007886) |
| mature miRNAs for MI0015560: |
| cin-miR-4014-2-5p (MIMAT0016976): GCACCACGAGCTTTTTGGAA |
| cin-miR-4014-3p (MIMAT0016519): TTACAGAAAGCGTGTGTGTG |
| You can find this miRNA in ENTREZGENE: mir4014-2 (accession: 100499147) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |