| Basic information from miRBase |
| hairpin accession number: MI0008498 |
| Located between position 150537198 and 150537275 on chromosome 1 strand - |
| Overlapping with antisense strand of FMO3_PANTR (intron 1). |
| (Ensemble: ENSPTRT00000061535) |
| mature miRNAs for MI0008498: |
| ptr-miR-1295 (MIMAT0008014): TTAGGCCGCAGATCTGGGTGA |
| You can find this miRNA in ENTREZGENE: MIR1295 (accession: 100316085) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |