| Basic information from miRBase |
| hairpin accession number: MI0017302 |
| Located between position 234442213 and 234442285 on chromosome 1 strand + |
| Overlapping with sense strand of SLC35F3-002 (intron 2). |
| (Ensemble: OTTHUMT00000128322) |
| mature miRNAs for MI0017302: |
| hsa-miR-4671-5p (MIMAT0019752): ACCGAAGACTGTGCGCTAATCT |
| hsa-miR-4671-3p (MIMAT0019753): TTAGTGCATAGTCTTTGGTCT |
| References |
| [1]Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C, Cancer Res. 71:78-86(2011)., "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" |