| Basic information from miRBase |
| hairpin accession number: MI0008628 |
| Located between position 182501715 and 182501808 on chromosome 5 strand - |
| Overlapping with sense strand of (intron 2). |
| (Ensemble: ENSPTRT00000064845) |
| mature miRNAs for MI0008628: |
| ptr-miR-340 (MIMAT0008109): TTATAAAGCAATGAGACTGATT |
| You can find this miRNA in ENTREZGENE: MIR340 (accession: 100316524) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |