| Basic information from miRBase |
| hairpin accession number: MI0008643 |
| Located between position 73649512 and 73649582 on chromosome X strand - |
| mature miRNAs for MI0008643: |
| ptr-miR-374a (MIMAT0008123): TTATAATACAACCTGATAAGTG |
| You can find this miRNA in ENTREZGENE: MIR374A (accession: 100316154) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |