| Basic information from miRBase |
| hairpin accession number: MI0012956 |
| Located between position 65084146 and 65084216 on chromosome X strand - |
| Overlapping with sense strand of LOC100072281 (intron 9). |
| (Ensemble: ENSECAT00000020467) |
| mature miRNAs for MI0012956: |
| eca-miR-361-5p (MIMAT0013208): TTATCAGAATCTCCAGGGGTAC |
| eca-miR-361-3p (MIMAT0013209): TCCCCCAGGCGTGATTCTGATTT |
| You can find this miRNA in ENTREZGENE: MIR361 (accession: 100314941) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |