miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0014908
Located between position 84302603 and 84302674 on chromosome X strand -
mature miRNAs for MI0014908:
         ppy-miR-361-5p (MIMAT0015848): TTATCAGAATCTCCAGGGGTAC
         ppy-miR-361-3p (MIMAT0015849): TCCCCCAGGTGTGATTCTGATTT

References
[1]Brameier M, BMC Res Notes. 3:64(2010)., "Genome-wide comparative analysis of microRNAs in three non-human primates"