| Basic information from miRBase |
| hairpin accession number: MI0008794 |
| Located between position 150998020 and 150998115 on chromosome 5 strand - |
| Overlapping with sense strand of XM_527069.2 (intron 1). |
| (Ensemble: ENSPTRT00000032177) |
| mature miRNAs for MI0008794: |
| ptr-miR-584 (MIMAT0008257): TTATGGTTTGCCTGGGACTGAG |
| You can find this miRNA in ENTREZGENE: MIR584 (accession: 100316235) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |