| Basic information from miRBase |
| hairpin accession number: MI0008538 |
| Located between position 99606251 and 99606351 on chromosome 1 strand - |
| mature miRNAs for MI0008538: |
| ptr-miR-137 (MIMAT0008033): TTATTGCTTAAGAATACGCGTAG |
| You can find this miRNA in ENTREZGENE: MIR137 (accession: 100316320) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |