Basic information from miRBase |
hairpin accession number: MI0005872 |
Located between position 16679027 and 16679080 on chromosome 3R strand - |
Overlapping with sense strand of Ir93a-RC (intron 4). |
(Ensemble: FBtr0299720) (FlyBase: FlyBase) |
mature miRNAs for MI0005872: |
dme-miR-1011-3p (MIMAT0005024): TTATTGGTTCAAATCGCTCGCAG |
References |
[1]Ruby JG, Jan CH, Bartel DP, Nature. 448:83-86(2007)., "Intronic microRNA precursors that bypass Drosha processing" |
more data |
Data from CoGemiR |