| Basic information from miRBase |
| hairpin accession number: MI0009910 |
| Located between position 122474331 and 122474411 on chromosome 6 strand - |
| Overlapping with sense strand of (intron 15). |
| (Ensemble: ENSBTAT00000021189) |
| mature miRNAs for MI0009910: |
| bta-miR-95 (MIMAT0009387): TTCAACGGGTATTTATTGAGCA |
| You can find this miRNA in ENTREZGENE: MIR95 (accession: 100313090) |
| References |
| [1]Artzi S, Kiezun A, Shomron N, BMC Bioinformatics. 9:39(2008)., "miRNAminer: a tool for homologous microRNA gene search" |
| [2]Strozzi F, Mazza R, Malinverni R, Williams JL, Anim Genet. 40:125(2009)., "Annotation of 390 bovine miRNA genes by sequence similarity with other species" |