miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0001925
Located between position 21171567 and 21171694 on chromosome 2 strand +
Overlapping with sense strand of ctdsplb-201 (intron 4).
(Ensemble: ENSDART00000089433)
mature miRNAs for MI0001925:
         dre-miR-26a (MIMAT0001794): TTCAAGTAATCCAGGATAGGCT
You can find this miRNA in ENTREZGENE: mir26a-2 (accession: 100033596)

References
[1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning"