| Basic information from miRBase |
| hairpin accession number: MI0002641 |
| Located between position 38836853 and 38836929 on chromosome 3 strand + |
| Overlapping with sense strand of (intron 4). |
| (Ensemble: ENSPTRT00000047611) |
| mature miRNAs for MI0002641: |
| ptr-miR-26a (MIMAT0002344): TTCAAGTAATCCAGGATAGGCT |
| You can find this miRNA in EMBL: AY865979 (accession: AY865979) |
| References |
| [1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |