miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008589
Located between position 31777776 and 31777858 on chromosome 12 strand +
Overlapping with sense strand of XM_001167131.1 (intron 5).
(Ensemble: ENSPTRT00000009481)
mature miRNAs for MI0008589:
         ptr-miR-26a (MIMAT0002344): TTCAAGTAATCCAGGATAGGCT
You can find this miRNA in ENTREZGENE: MIR26A-2 (accession: 100316126)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"