Basic information from miRBase |
hairpin accession number: MI0008589 |
Located between position 31777776 and 31777858 on chromosome 12 strand + |
Overlapping with sense strand of XM_001167131.1 (intron 5). |
(Ensemble: ENSPTRT00000009481) |
mature miRNAs for MI0008589: |
ptr-miR-26a (MIMAT0002344): TTCAAGTAATCCAGGATAGGCT |
You can find this miRNA in ENTREZGENE: MIR26A-2 (accession: 100316126) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |