| Basic information from miRBase |
| hairpin accession number: MI0001927 |
| Located between position 24962546 and 24962642 on chromosome 23 strand - |
| Overlapping with sense strand of zgc:77714-003 (intron 4). |
| (Ensemble: OTTDART00000028070) |
| mature miRNAs for MI0001927: |
| dre-miR-26b (MIMAT0001795): TTCAAGTAATCCAGGATAGGTT |
| You can find this miRNA in ENTREZGENE: mir26b (accession: 100033598) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |