| Basic information from miRBase |
| hairpin accession number: MI0008590 |
| Located between position 224316472 and 224316547 on chromosome 2b strand + |
| Overlapping with sense strand of XM_001156881.1 (intron 4). |
| (Ensemble: ENSPTRT00000023949) |
| mature miRNAs for MI0008590: |
| ptr-miR-26b (MIMAT0008077): TTCAAGTAATTCAGGATAGGT |
| You can find this miRNA in ENTREZGENE: MIR26B (accession: 100316127) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |