miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0000440
Located between position 97847727 and 97847823 on chromosome 9 strand +
Overlapping with sense strand of C9orf3-016 (intron 6).
(Ensemble: OTTHUMT00000053211)
mature miRNAs for MI0000440:
         hsa-miR-27b* (MIMAT0004588): AGAGCTTAGCTGATTGGTGAAC
         hsa-miR-27b (MIMAT0000419): TTCACAGTGGCTAAGTTCTGC
You can find this miRNA in TARGETS:PICTAR-VERT: hsa-miR-27b (accession: hsa-miR-27b)

References
[1]Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T, Curr Biol. 12:735-739(2002)., "Identification of tissue-specific microRNAs from mouse"
[2]Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ, Mol Cancer Res. 1:882-891(2003)., "Reduced accumulation of specific microRNAs in colorectal neoplasia"
[3]Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G, RNA. 9:180-186(2003)., "Numerous microRNPs in neuronal cells containing novel microRNAs"
[4]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[5]Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer"


PROMOTER INFORMATION
PROMOTER ID
LOCALIZATION
SEQUENCE
REFERENCE
SNP
TFBS
510 chr9, 96857925-96859033, + promoter sequence Fujita et al.
779 chr9, 96882548-96887644, + promoter sequence UCSC
1269 chr9, 96850881-96855880, + promoter sequence Corcoran et al.


more data
Expression data from dbDEMC
Expression data from PhenomiR
Pathway information from dPORE-miRNA