Basic information from miRBase |
hairpin accession number: MI0000440 |
Located between position 97847727 and 97847823 on chromosome 9 strand + |
Overlapping with sense strand of C9orf3-016 (intron 6). |
(Ensemble: OTTHUMT00000053211) |
mature miRNAs for MI0000440: |
hsa-miR-27b* (MIMAT0004588): AGAGCTTAGCTGATTGGTGAAC |
hsa-miR-27b (MIMAT0000419): TTCACAGTGGCTAAGTTCTGC |
You can find this miRNA in TARGETS:PICTAR-VERT: hsa-miR-27b (accession: hsa-miR-27b) |
References | ||||||||||||||
[1]Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T, Curr Biol. 12:735-739(2002)., "Identification of tissue-specific microRNAs from mouse" | ||||||||||||||
[2]Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ, Mol Cancer Res. 1:882-891(2003)., "Reduced accumulation of specific microRNAs in colorectal neoplasia" | ||||||||||||||
[3]Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G, RNA. 9:180-186(2003)., "Numerous microRNPs in neuronal cells containing novel microRNAs" | ||||||||||||||
[4]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" | ||||||||||||||
[5]Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer" |
PROMOTER INFORMATION | ||||||||||||||
510 | chr9, 96857925-96859033, + | promoter sequence | Fujita et al. | |||||||||||
779 | chr9, 96882548-96887644, + | promoter sequence | UCSC | |||||||||||
1269 | chr9, 96850881-96855880, + | promoter sequence | Corcoran et al. |
more data |
Expression data from dbDEMC |
Expression data from PhenomiR |
Pathway information from dPORE-miRNA |