| Basic information from miRBase |
| hairpin accession number: MI0008591 |
| Located between position 94275502 and 94275597 on chromosome 9 strand + |
| Overlapping with sense strand of (intron 15). |
| (Ensemble: ENSPTRT00000039097) |
| mature miRNAs for MI0008591: |
| ptr-miR-27b (MIMAT0008078): TTCACAGTGGCTAAGTTCTGC |
| You can find this miRNA in ENTREZGENE: MIR27B (accession: 100316378) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |