miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0000859
Located between position 7351449 and 7351545 on chromosome 17 strand -
mature miRNAs for MI0000859:
         rno-miR-27b* (MIMAT0017101): AGAGCTTAGCTGATTGGTGAACAG
         rno-miR-27b (MIMAT0000798): TTCACAGTGGCTAAGTTCTGC
You can find this miRNA in ENTREZGENE: Mir27b (accession: 100314005)

References
[1]Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H, Genes Dev. 20:1732-1743(2006)., "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes"
[2]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[3]He X, Zhang Q, Liu Y, Pan X, Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007)., "Cloning and identification of novel microRNAs from rat hippocampus"
[4]Linsen SE, de Wit E, de Bruijn E, Cuppen E, BMC Genomics. 11:249(2010)., "Small RNA expression and strain specificity in the rat"