Basic information from miRBase |
hairpin accession number: MI0005806 |
Located between position 646752 and 646838 on chromosome 4 strand + |
mature miRNAs for MI0005806: |
dme-miR-954-5p (MIMAT0005465): TCTGGGTGTTGCGTTGTGTGT |
dme-miR-954-3p (MIMAT0020846): TTCACATGCAACATCCCTTAC |
References |
[1]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" |
more data |
Data from CoGemiR |