miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0006218
Located between position 1919702 and 1919968 on chromosome scaffold_16 strand +
mature miRNAs for MI0006218:
         cre-miR1156.1 (MIMAT0005405): TGGACCCTCGCATGTCCGTGA
         cre-miR1156.2 (MIMAT0005406): TTCAGCTGGAGCTTCAGGCAC

References
[1]Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC, Nature. 447:1126-1129(2007)., "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii"