miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0012944
Located between position 90781532 and 90781642 on chromosome X strand +
mature miRNAs for MI0012944:
         eca-miR-1298 (MIMAT0013196): TTCATTCGGCTGTCCAGATGTA
You can find this miRNA in ENTREZGENE: MIR1298 (accession: 100314934)

References
[1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach"