| Basic information from miRBase |
| hairpin accession number: MI0008502 |
| Located between position 114304784 and 114304894 on chromosome X strand + |
| Overlapping with sense strand of 5HT2C_PANTR (intron 2). |
| (Ensemble: ENSPTRT00000041367) |
| mature miRNAs for MI0008502: |
| ptr-miR-1298 (MIMAT0008017): TTCATTCGGCTGTCCAGATGTA |
| You can find this miRNA in ENTREZGENE: MIR1298 (accession: 100316317) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |