| Basic information from miRBase |
| hairpin accession number: MI0008789 |
| Located between position 83361983 and 83362079 on chromosome 5 strand + |
| Overlapping with sense strand of XR_020129.1 (intron 9). |
| (Ensemble: ENSPTRT00000031139) RefSeq_dna: RefSeq) |
| mature miRNAs for MI0008789: |
| ptr-miR-579 (MIMAT0008252): TTCATTTGGTATAAACCGCGATT |
| You can find this miRNA in ENTREZGENE: MIR579 (accession: 100316491) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |