| Basic information from miRBase |
| hairpin accession number: MI0010569 |
| Located between position 2280 and 2353 on chromosome AZM5_11578 strand - |
| mature miRNAs for MI0010569: |
| zma-miR396c (MIMAT0010076): TTCCACAGGCTTTCTTGAACTG |
| References |
| [1]Xue LJ, Zhang JJ, Xue HW, Nucleic Acids Res. 37:916-930(2009)., "Characterization and expression profiles of miRNAs in rice seeds" |
| [2]Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D, PLoS Genet. 5:e1000716(2009)., "A genome-wide characterization of microRNA genes in maize" |